This report was generated by the AREE workflows/rnaseq Nextflow scaffold.
+
+
+
+
+
+
Field
+
Value
+
+
+
+
+
workflow_name
+
aree-rnaseq
+
+
+
workflow_version
+
0.1.0-scaffold
+
+
+
mode
+
raw_reanalysis
+
+
+
study_id
+
PERUZZA2023_HEATWAVE
+
+
+
comparison_id
+
heatwave_30c_vs_control_20c
+
+
+
workflow_start
+
2026-10-17T00:01:30.595202-07:00
+
+
+
+
+
+
+
+
Warnings
+
+
+
No warnings recorded.
+
+
+
If mode is processed_results_harmonization, note that raw FASTQ QC (FastQC/fastp/Salmon mapping rate) could not be independently verified — see the warnings array above and docs/design.md section 7.
+
+
+
Sample exclusions and viral read QC
+
+
+
No samples were excluded from differential expression.
+
+
+
Viral read QC was not run (no --viral_reference).
+
+
+
+
+
Differential expression summary
+
+
+
Loaded 32634 features. 2993 features have padj < 0.05.
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
gene_id
+
baseMean
+
log2FoldChange
+
lfcSE
+
stat
+
pvalue
+
padj
+
+
+
+
+
132748986
+
236.97008
+
3.5510148
+
0.2719801
+
13.056154
+
0
+
0
+
+
+
132717138
+
37.29991
+
-2.0424436
+
0.1584609
+
-12.889261
+
0
+
0
+
+
+
132719805
+
3390.21245
+
0.9246916
+
0.0837833
+
11.036708
+
0
+
0
+
+
+
132743800
+
1010.24938
+
-7.8869366
+
0.7130007
+
-11.061611
+
0
+
0
+
+
+
132742357
+
308.77911
+
-1.7389103
+
0.1604199
+
-10.839742
+
0
+
0
+
+
+
132727225
+
696.50499
+
-1.5395985
+
0.1436309
+
-10.719129
+
0
+
0
+
+
+
132721565
+
382.43123
+
0.8225794
+
0.0781836
+
10.521128
+
0
+
0
+
+
+
132739104
+
183.52205
+
-5.4569203
+
0.5923411
+
-9.212463
+
0
+
0
+
+
+
132739703
+
317.09102
+
3.4803608
+
0.3792388
+
9.177227
+
0
+
0
+
+
+
132752448
+
36.84256
+
-1.5266458
+
0.1725199
+
-8.849097
+
0
+
0
+
+
+
+
+
+
+
+
Volcano plot
+
+
+
+
+
+
+
+
+
+
+
+
Provenance
+
Source file checksums, tool versions, and parameters are recorded in PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_manifest.json, emitted by the EMIT_MANIFEST process. This report does not duplicate that data verbatim; consult the manifest for the authoritative, machine-readable record.
+
+
Generated by the AREE workflows/rnaseq scaffold. This report template has not been rendered against real pipeline outputs in this build — see workflows/rnaseq/README.md.
+
+
+
+
+
+
+
+
+
+
+
\ No newline at end of file
diff --git a/data/studies/PERUZZA2023_HEATWAVE/PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_workflow_manifest.json b/data/studies/PERUZZA2023_HEATWAVE/PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_workflow_manifest.json
new file mode 100644
index 0000000..576f0a7
--- /dev/null
+++ b/data/studies/PERUZZA2023_HEATWAVE/PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_workflow_manifest.json
@@ -0,0 +1,127 @@
+{
+ "workflow_name": "aree-rnaseq",
+ "workflow_version": "0.1.0-scaffold",
+ "mode": "raw_reanalysis",
+ "study_id": "PERUZZA2023_HEATWAVE",
+ "comparison_id": "heatwave_30c_vs_control_20c",
+ "input_files": [
+ {
+ "name": "PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_dge_standardized.tsv",
+ "sha256": "cac70a4f116ca15fbd7d8b716817393f1f33370e1f89bd979292243ba4fd4923"
+ }
+ ],
+ "parameters": {
+ "mode": "raw_reanalysis",
+ "study_id": "PERUZZA2023_HEATWAVE",
+ "comparison_id": "heatwave_30c_vs_control_20c",
+ "outdir": "results/rnaseq/PERUZZA2023_HEATWAVE/heatwave_30c_vs_control_20c",
+ "exclude_samples": [],
+ "control_levels": [
+ "20"
+ ],
+ "treatment_levels": [
+ "30"
+ ],
+ "replicate_unit": null,
+ "covariates": [
+ "sex"
+ ],
+ "single_end": true,
+ "se_adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA",
+ "tag_seq": true,
+ "viral_reference": null,
+ "exclude_genes": null
+ },
+ "deseq2_design": {
+ "design": "~sex + condition",
+ "covariates_requested": [
+ "sex"
+ ],
+ "covariates_used": [
+ "sex"
+ ],
+ "covariates_dropped_constant": [],
+ "tag_seq": true,
+ "length_model": "none: counts without length offsets (tag_seq)",
+ "exclude_genes": null,
+ "n_libraries_or_units": 40,
+ "residual_df": 37
+ },
+ "software_versions": {
+ "DIFFERENTIAL_EXPRESSION_DESEQ2": {
+ "bioconductor-deseq2": "1.50.2",
+ "bioconductor-tximport": "1.38.2",
+ "r-base": "4.5.3"
+ },
+ "FASTQC": {
+ "fastqc": "0.12.1"
+ },
+ "SALMON_QUANT": {
+ "salmon": "2.8.0"
+ },
+ "SAMPLE_QC": {
+ "multiqc": "1.35"
+ },
+ "STANDARDIZE_OUTPUT": {
+ "pandas": "3.0.6",
+ "python": "3.11.17"
+ },
+ "TRIM_FASTP": {
+ "fastp": "1.4.0"
+ },
+ "EMIT_MANIFEST": {
+ "python": "3.11.17"
+ }
+ },
+ "software_versions_not_captured": {
+ "RENDER_REPORT": "renders this manifest, so it runs afterwards; its versions.yml is published to rnaseq/reports/"
+ },
+ "container_engine": null,
+ "reference": {
+ "genome_assembly": "GCF_026571515.1",
+ "annotation_version": "GCF_026571515.1-RS_2023_10",
+ "transcript_fasta": "data/reference/GCF_026571515.1/rna.fna",
+ "gtf": "data/reference/GCF_026571515.1/genomic.gtf",
+ "tx2gene": "data/reference/GCF_026571515.1/tx2gene.tsv",
+ "salmon_index": "/Users/sr320/aree-data/reference/GCF_026571515.1/salmon_index",
+ "files": [
+ {
+ "name": "genomic.gtf",
+ "sha256": "99299a6252c91d941eee4ae579ff540ef08019317ae3c44a7927500cdd46eb0b",
+ "matches_bundle_provenance": true
+ },
+ {
+ "name": "reference_provenance.json",
+ "sha256": "a39261e783dccf164ed976d93a25abc1f871f0d47ffd437218041f3b6cfeb67b"
+ },
+ {
+ "name": "rna.fna",
+ "sha256": "2c45a6c9478b0ff312737772ee3c23019468042fd09bbf2a25a7f263cbfe4014",
+ "matches_bundle_provenance": true
+ },
+ {
+ "name": "tx2gene.tsv",
+ "sha256": "1f76e774cf67286927a3428f570f3f899246e7849e2a60a5a1459de2e396a961",
+ "matches_bundle_provenance": true
+ }
+ ],
+ "bundle": {
+ "bundle": "GCF_026571515.1",
+ "assembly_id": "ASM2657151v2",
+ "ncbi_assembly_accession": "GCF_026571515.1",
+ "annotation_source": "NCBI RefSeq GCF_026571515.1-RS_2023_10",
+ "annotation_release_matches_registry": true,
+ "date_generated": "2026-10-13",
+ "bundler_version": "1.0.0"
+ }
+ },
+ "workflow_start": "2026-10-17T00:01:30.595202-07:00",
+ "qc_metrics": {
+ "mean_reads_per_sample": null,
+ "mean_mapping_rate_percent": null,
+ "n_samples": null,
+ "note": "QC metrics are not populated in processed_results_harmonization mode or in this unexecuted scaffold run."
+ },
+ "viral_load": null,
+ "warnings": []
+}
\ No newline at end of file
diff --git a/data/studies/PERUZZA2023_HEATWAVE/ena_provenance.json b/data/studies/PERUZZA2023_HEATWAVE/ena_provenance.json
new file mode 100644
index 0000000..5135435
--- /dev/null
+++ b/data/studies/PERUZZA2023_HEATWAVE/ena_provenance.json
@@ -0,0 +1,44 @@
+{
+ "study_id": "PERUZZA2023_HEATWAVE",
+ "bioproject": "PRJNA906528",
+ "date_generated": "2026-10-15",
+ "generated_by": "src/intake/ena_samplesheet.py",
+ "queries": {
+ "run_report": "https://www.ebi.ac.uk/ena/portal/api/filereport?accession=PRJNA906528&result=read_run&fields=run_accession,sample_accession,sample_alias,experiment_accession,library_strategy,library_layout,library_selection,instrument_model,read_count,base_count,fastq_ftp,fastq_md5,fastq_bytes,submitted_ftp,submitted_md5,submitted_bytes,submitted_format",
+ "sample_xml": "https://www.ebi.ac.uk/ena/browser/api/xml/"
+ },
+ "condition_attributes": [
+ "temp"
+ ],
+ "n_runs": 40,
+ "n_samples": 40,
+ "library_strategies": [
+ "RNA-Seq"
+ ],
+ "library_layouts": [
+ "SINGLE"
+ ],
+ "group_sizes": {
+ "20": 20,
+ "30": 20
+ },
+ "min_group_size": 20,
+ "total_fastq_bytes": 7900304210,
+ "fastq_sources": {
+ "fastq_ftp": 40,
+ "submitted_ftp": 0
+ },
+ "outputs": {
+ "data/studies/PERUZZA2023_HEATWAVE/samplesheet.tsv": "0429ae867bd0009cca418e848e7e1c65c61b32e27cd68e4437ef7ea7f53d598b",
+ "data/studies/PERUZZA2023_HEATWAVE/fastq_manifest.tsv": "f39a9869be0bd86fe04e89b1d479d632e958942551109fc5fb14229c25f3868d"
+ },
+ "library_strategy_filter": {
+ "kept": [
+ "RNA-Seq"
+ ],
+ "runs_by_strategy_before_filter": {
+ "AMPLICON": 39,
+ "RNA-Seq": 40
+ }
+ }
+}
diff --git a/data/studies/PERUZZA2023_HEATWAVE/fastq_manifest.tsv b/data/studies/PERUZZA2023_HEATWAVE/fastq_manifest.tsv
new file mode 100644
index 0000000..947971a
--- /dev/null
+++ b/data/studies/PERUZZA2023_HEATWAVE/fastq_manifest.tsv
@@ -0,0 +1,41 @@
+run_accession mate url md5 bytes source
+SRR22444642 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/042/SRR22444642/SRR22444642.fastq.gz cf9352e5b70effd1a1f5ee96313b5858 197762464 fastq_ftp
+SRR22444643 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/043/SRR22444643/SRR22444643.fastq.gz 7675a9b2a4d6103a64bb03aa0ea4d088 218053374 fastq_ftp
+SRR22444644 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/044/SRR22444644/SRR22444644.fastq.gz 8de19270ec40d36442a80caeafbef06f 177984544 fastq_ftp
+SRR22444645 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/045/SRR22444645/SRR22444645.fastq.gz 86b6e94c7e03d142b5a90eb04744c970 230621361 fastq_ftp
+SRR22444646 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/046/SRR22444646/SRR22444646.fastq.gz db1178abb8e16c26ac064c866ed797a5 181904676 fastq_ftp
+SRR22444647 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/047/SRR22444647/SRR22444647.fastq.gz c4759993e0e0a664b9263528cab27fdf 184832659 fastq_ftp
+SRR22444648 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/048/SRR22444648/SRR22444648.fastq.gz 7c0768e16a333e6bd27eae7f4ab5cdd9 182725179 fastq_ftp
+SRR22444649 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/049/SRR22444649/SRR22444649.fastq.gz 1fbd68a48d5fcdfc8321aaade05df24e 236510308 fastq_ftp
+SRR22444650 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/050/SRR22444650/SRR22444650.fastq.gz 7a98b8878f943ff610c85defdd109685 213622334 fastq_ftp
+SRR22444651 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/051/SRR22444651/SRR22444651.fastq.gz 3c2c67ad260e7216ffcb8f287527e5ef 186676900 fastq_ftp
+SRR22444652 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/052/SRR22444652/SRR22444652.fastq.gz 0559218664804d5708be79326e802d1d 221646742 fastq_ftp
+SRR22444653 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/053/SRR22444653/SRR22444653.fastq.gz 4ceef9f2d5e61be8f4d4944ef99076cb 222296749 fastq_ftp
+SRR22444654 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/054/SRR22444654/SRR22444654.fastq.gz b1cfe7bd136b56eb861e3544d3405d5a 174130444 fastq_ftp
+SRR22444655 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/055/SRR22444655/SRR22444655.fastq.gz 0f67869bd7a8a20ac574aca38619db55 179815250 fastq_ftp
+SRR22444656 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/056/SRR22444656/SRR22444656.fastq.gz fb81f819e69241e96306d7683bb091d9 161605850 fastq_ftp
+SRR22444657 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/057/SRR22444657/SRR22444657.fastq.gz 621c83125e9f725fca34484fb4a80349 208938108 fastq_ftp
+SRR22444658 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/058/SRR22444658/SRR22444658.fastq.gz a0691b95b753ee3588dc2a3d33a8da87 225884052 fastq_ftp
+SRR22444659 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/059/SRR22444659/SRR22444659.fastq.gz 882a3c6ed9971afbf61110f4fdbf09c9 179944334 fastq_ftp
+SRR22444660 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/060/SRR22444660/SRR22444660.fastq.gz 8e10521dec891fb46ea1fa595eb74e2e 210853211 fastq_ftp
+SRR22444661 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/061/SRR22444661/SRR22444661.fastq.gz 87da2729e5afab05893598f34c6d6da4 176013741 fastq_ftp
+SRR22444662 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/062/SRR22444662/SRR22444662.fastq.gz 03cf5bb92dcda6fabb92070d4a8b5236 166677741 fastq_ftp
+SRR22444663 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/063/SRR22444663/SRR22444663.fastq.gz 7098f750f7439d8c3e9c0b9f3a5cf54b 191201985 fastq_ftp
+SRR22444664 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/064/SRR22444664/SRR22444664.fastq.gz 01b59ff48c11bdcd9facbea382298a20 202747157 fastq_ftp
+SRR22444665 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/065/SRR22444665/SRR22444665.fastq.gz 730027e65f4985700f783faccc8f571d 209424045 fastq_ftp
+SRR22444666 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/066/SRR22444666/SRR22444666.fastq.gz 7cb4f7cb92cc172ffb8ea64e3ede7de2 214889192 fastq_ftp
+SRR22444667 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/067/SRR22444667/SRR22444667.fastq.gz f8185e731853c7b0504d001c7b264793 192909322 fastq_ftp
+SRR22444668 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/068/SRR22444668/SRR22444668.fastq.gz 3f8b07deb44140703823f99705b9909b 196220306 fastq_ftp
+SRR22444669 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/069/SRR22444669/SRR22444669.fastq.gz 9ca0390769ed132570ccdb99a58d122c 213055498 fastq_ftp
+SRR22444670 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/070/SRR22444670/SRR22444670.fastq.gz 5525bb9f36f677a6e32aecec33047ce6 141227025 fastq_ftp
+SRR22444671 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/071/SRR22444671/SRR22444671.fastq.gz f70854f000bc25bc32d90aab8150334e 202366128 fastq_ftp
+SRR22444672 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/072/SRR22444672/SRR22444672.fastq.gz 945918b39f60b17a6424b655b77b2a41 230671107 fastq_ftp
+SRR22444673 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/073/SRR22444673/SRR22444673.fastq.gz 1efa7fa007bd5637fec5c5724a714507 224022840 fastq_ftp
+SRR22444674 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/074/SRR22444674/SRR22444674.fastq.gz 3a2d0c5ba0804cbc2d000e91e6394115 212246200 fastq_ftp
+SRR22444675 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/075/SRR22444675/SRR22444675.fastq.gz fadaf625fb1c805c68768a7e57cb0c7d 189986389 fastq_ftp
+SRR22444676 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/076/SRR22444676/SRR22444676.fastq.gz 032b15097cec7b9116b5b4b27d82ac0d 223190201 fastq_ftp
+SRR22444677 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/077/SRR22444677/SRR22444677.fastq.gz 490cf395766f265ff479b79a1b44839b 218199507 fastq_ftp
+SRR22444678 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/078/SRR22444678/SRR22444678.fastq.gz e3f81d1b881da8cd535cc58f70ea2506 175649321 fastq_ftp
+SRR22444679 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/079/SRR22444679/SRR22444679.fastq.gz 3a8b8cb9fb8c887c65f97dbb9ac9e5c4 165851248 fastq_ftp
+SRR22444680 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/080/SRR22444680/SRR22444680.fastq.gz b733dda392ac45885e53cab961e8e92d 208675189 fastq_ftp
+SRR22444681 1 ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR224/081/SRR22444681/SRR22444681.fastq.gz 620d2f90befac87cd6b09079c508635c 149271529 fastq_ftp
diff --git a/data/studies/PERUZZA2023_HEATWAVE/replicate_dispersion_qc.tsv b/data/studies/PERUZZA2023_HEATWAVE/replicate_dispersion_qc.tsv
new file mode 100644
index 0000000..94f516f
--- /dev/null
+++ b/data/studies/PERUZZA2023_HEATWAVE/replicate_dispersion_qc.tsv
@@ -0,0 +1,3 @@
+condition n_samples samples n_genes median_dispersion passes
+20 20 CTRL-107,CTRL-115,CTRL-122,CTRL-160,CTRL-167,CTRL-188,CTRL-190,CTRL-2,CTRL-212,CTRL-227,CTRL-233,CTRL-28,CTRL-38,CTRL-52,CTRL-65,CTRL-71,CTRL-77,CTRL-87,CTRL-94,CTRL-95 903 0.09657 True
+30 20 HW-113,HW-117,HW-145,HW-151,HW-154,HW-157,HW-159,HW-163,HW-165,HW-17,HW-19,HW-218,HW-238,HW-43,HW-46,HW-61,HW-85,HW-88,HW-91,HW-96 901 0.09313 True
diff --git a/data/studies/PERUZZA2023_HEATWAVE/samplesheet.tsv b/data/studies/PERUZZA2023_HEATWAVE/samplesheet.tsv
new file mode 100644
index 0000000..e795049
--- /dev/null
+++ b/data/studies/PERUZZA2023_HEATWAVE/samplesheet.tsv
@@ -0,0 +1,41 @@
+sample_id run_accession sample_accession sample_alias condition temp sex library_layout instrument_model read_count
+CTRL-87 SRR22444642 SAMN31927501 CTRL-87 20 20 male SINGLE Illumina NovaSeq 6000 7046306
+CTRL-77 SRR22444643 SAMN31927500 CTRL-77 20 20 female SINGLE Illumina NovaSeq 6000 7807579
+CTRL-65 SRR22444644 SAMN31927499 CTRL-65 20 20 male SINGLE Illumina NovaSeq 6000 6418153
+CTRL-52 SRR22444645 SAMN31927498 CTRL-52 20 20 male SINGLE Illumina NovaSeq 6000 8193471
+CTRL-38 SRR22444646 SAMN31927497 CTRL-38 20 20 female SINGLE Illumina NovaSeq 6000 6495378
+CTRL-28 SRR22444647 SAMN31927496 CTRL-28 20 20 female SINGLE Illumina NovaSeq 6000 6740638
+HW-96 SRR22444648 SAMN31927531 HW-96 30 30 female SINGLE Illumina NovaSeq 6000 6450084
+HW-88 SRR22444649 SAMN31927530 HW-88 30 30 female SINGLE Illumina NovaSeq 6000 8473431
+HW-85 SRR22444650 SAMN31927529 HW-85 30 30 male SINGLE Illumina NovaSeq 6000 7650513
+HW-61 SRR22444651 SAMN31927528 HW-61 30 30 male SINGLE Illumina NovaSeq 6000 6585959
+HW-43 SRR22444652 SAMN31927527 HW-43 30 30 male SINGLE Illumina NovaSeq 6000 7837570
+HW-19 SRR22444653 SAMN31927526 HW-19 30 30 female SINGLE Illumina NovaSeq 6000 7935526
+HW-165 SRR22444654 SAMN31927525 HW-165 30 30 male SINGLE Illumina NovaSeq 6000 6675602
+HW-157 SRR22444655 SAMN31927524 HW-157 30 30 female SINGLE Illumina NovaSeq 6000 6338603
+HW-117 SRR22444656 SAMN31927523 HW-117 30 30 male SINGLE Illumina NovaSeq 6000 5670438
+HW-113 SRR22444657 SAMN31927522 HW-113 30 30 male SINGLE Illumina NovaSeq 6000 7384959
+CTRL-233 SRR22444658 SAMN31927495 CTRL-233 20 20 male SINGLE Illumina NovaSeq 6000 7960760
+CTRL-95 SRR22444659 SAMN31927521 CTRL-95 20 20 male SINGLE Illumina NovaSeq 6000 6504754
+CTRL-94 SRR22444660 SAMN31927520 CTRL-94 20 20 male SINGLE Illumina NovaSeq 6000 7520270
+CTRL-71 SRR22444661 SAMN31927519 CTRL-71 20 20 male SINGLE Illumina NovaSeq 6000 6379912
+CTRL-2 SRR22444662 SAMN31927518 CTRL-2 20 20 male SINGLE Illumina NovaSeq 6000 5953785
+CTRL-212 SRR22444663 SAMN31927517 CTRL-212 20 20 male SINGLE Illumina NovaSeq 6000 6781876
+CTRL-190 SRR22444664 SAMN31927516 CTRL-190 20 20 male SINGLE Illumina NovaSeq 6000 7251871
+CTRL-188 SRR22444665 SAMN31927515 CTRL-188 20 20 female SINGLE Illumina NovaSeq 6000 7481513
+CTRL-160 SRR22444666 SAMN31927514 CTRL-160 20 20 male SINGLE Illumina NovaSeq 6000 7601195
+CTRL-115 SRR22444667 SAMN31927513 CTRL-115 20 20 male SINGLE Illumina NovaSeq 6000 6988848
+CTRL-107 SRR22444668 SAMN31927512 CTRL-107 20 20 female SINGLE Illumina NovaSeq 6000 6891927
+CTRL-227 SRR22444669 SAMN31927494 CTRL-227 20 20 male SINGLE Illumina NovaSeq 6000 7466572
+HW-91 SRR22444670 SAMN31927511 HW-91 30 30 male SINGLE Illumina NovaSeq 6000 5084954
+HW-46 SRR22444671 SAMN31927510 HW-46 30 30 male SINGLE Illumina NovaSeq 6000 7265663
+HW-238 SRR22444672 SAMN31927509 HW-238 30 30 female SINGLE Illumina NovaSeq 6000 8343071
+HW-218 SRR22444673 SAMN31927508 HW-218 30 30 female SINGLE Illumina NovaSeq 6000 7974122
+HW-17 SRR22444674 SAMN31927507 HW-17 30 30 female SINGLE Illumina NovaSeq 6000 7527531
+HW-163 SRR22444675 SAMN31927506 HW-163 30 30 female SINGLE Illumina NovaSeq 6000 6736918
+HW-159 SRR22444676 SAMN31927505 HW-159 30 30 female SINGLE Illumina NovaSeq 6000 7994568
+HW-154 SRR22444677 SAMN31927504 HW-154 30 30 male SINGLE Illumina NovaSeq 6000 7714479
+HW-151 SRR22444678 SAMN31927503 HW-151 30 30 female SINGLE Illumina NovaSeq 6000 6267074
+HW-145 SRR22444679 SAMN31927502 HW-145 30 30 male SINGLE Illumina NovaSeq 6000 5876012
+CTRL-167 SRR22444680 SAMN31927493 CTRL-167 20 20 male SINGLE Illumina NovaSeq 6000 7520788
+CTRL-122 SRR22444681 SAMN31927492 CTRL-122 20 20 male SINGLE Illumina NovaSeq 6000 5557146
diff --git a/registry/studies/PERUZZA2023_HEATWAVE.yaml b/registry/studies/PERUZZA2023_HEATWAVE.yaml
new file mode 100644
index 0000000..d5b981b
--- /dev/null
+++ b/registry/studies/PERUZZA2023_HEATWAVE.yaml
@@ -0,0 +1,196 @@
+# SECOND REAL MANILA CLAM STUDY, claimed 2026-10-15 from the WP5 backlog
+# (docs/candidate_studies_mussels_clams.md, pool A: Manila clam heat). With
+# TUCCI2025_HEAT_PRIMING it forms the first within-species clam pool (k = 2)
+# on thermal_tolerance, which is also the first pool that can let a real
+# oyster-clam orthogroup clear the WP6 cross-species replication gate.
+#
+# Registered from deposited metadata and the publication, which is CONFIRMED:
+# Peruzza et al. 2023 (Mar Pollut Bull, open access, CC BY-NC-ND) gives
+# "BioProject ID: PRJNA906528" for the RNA-seq libraries, and its methods
+# (20 clams per arm, digestive gland, 75 bp single-end QuantSeq) match the
+# deposit.
+#
+# REANALYZED 2026-10-17 on Pori, fitted on clams with --tag_seq (no length
+# correction in Salmon or DESeq2) and ~ sex + condition. Heatwave (30 C) vs
+# control (20 C): 2,993 of 32,634 genes at padj < 0.05 (1,386 up, 1,607
+# down). An upper bound: tank, the unit of treatment, is not modelled
+# (limitations 2). Replicate dispersion QC passes (median 0.097 at 20 C,
+# 0.093 at 30 C). Salmon mapped 37.5-52.5% of reads; see limitations (1).
+#
+# INDEPENDENCE FROM TUCCI2025_HEAT_PRIMING (checked 2026-10-15). Same Padova
+# group and the same hatchery (SATMAR, France), but different animals: these
+# clams were bought in February 2021 and sampled in March 2021; Tucci's were
+# bought in February 2022. Different cohorts a year apart, different
+# experiments, different exposures. Counted as independent (k = 2).
+#
+# DESIGN AS PUBLISHED. 240 clams acclimated 15 d at 20 C, then randomly
+# allocated (randomizr) to control (20 C) or heatwave (30 C, reached by a
+# 2-day ramp) for 30 days; 4 tanks per arm, 30 clams per 25 L tank. A pilot
+# at 28, 30 and 32 C found no significant mortality at 30 C, so this is a
+# non-lethal exposure: no survival difference. At the end, 5 clams per tank
+# (20 per arm) were dissected; the digestive gland went to RNA-seq and 16S,
+# mantle and foot to enzymes and metabolomics. Sex was assigned by a
+# classifier trained on digestive-gland transcriptomes of 12 reference clams
+# sexed by microscopy (PRJNA906977, not used here). The authors analysed each
+# sex separately (RUVs k = 1, edgeR LRT, FDR < 0.05); AREE fits both sexes
+# with sex as a covariate.
+#
+# ONE COMPARISON, PRESPECIFIED 2026-10-15, BEFORE ANY DATA WERE RUN.
+# heatwave_30c_vs_control_20c is meta_analysis_primary: the contrast that
+# pools with TUCCI2025_HEAT_PRIMING's naive_hw_vs_naive_control (heatwave
+# exposure in unprimed clams, both exposure_only on thermal_tolerance).
+# Sample-sheet condition levels are 20 and 30 (BioSample attribute temp).
+# ---------------------------------------------------------------------------
+
+study_id: PERUZZA2023_HEATWAVE
+simulated: false
+
+accessions:
+ doi: "10.1016/j.marpolbul.2023.115192"
+ bioproject: "PRJNA906528"
+ geo: null
+ sra: "SRR22444642-SRR22444681 (40 RNA-seq runs)"
+ ena: "PRJNA906528"
+ proteomexchange: null
+ other: "BioSamples SAMN31927492-SAMN31927531 (one per clam, RNA-seq). The same BioProject holds 39 16S amplicon runs from the same RNA, which are not used. Sex-reference transcriptomes are in PRJNA906977 (not used)."
+
+citation: "Peruzza L, Tucci CF, Frizzo R, Riello T, Quagliariello A, Martino ME, Manuzzi A, Dalla Rovere G, Bonsembiante F, Gelain ME, Smits M, Borgheresi O, Camerani F, Panin M, Venier P, Mammi S, Hauton C, Patarnello T, Milan M, Bargelloni L (2023). Impaired reproduction, energy reserves and dysbiosis: the overlooked consequences of heatwaves in a bivalve mollusc. Marine Pollution Bulletin 193:115192. https://doi.org/10.1016/j.marpolbul.2023.115192 (PMID 37364338)."
+
+species: "Ruditapes philippinarum"
+strain_or_population: "Commercial hatchery stock from SATMAR (France), adults 25.7 +/- 1.9 mm shell length and 4.11 +/- 1.0 g, purchased February 2021; experiment in artificial seawater (32 PSU) at the University of Padova, March 2021. Sex assigned per clam by a transcriptome classifier (see limitations)."
+
+# AREE reanalyzes against the NCBI RefSeq annotation its Manila clam crosswalk
+# is built from. The authors mapped with STAR to the Xu et al. (2022) genome
+# and counted with featureCounts; that pipeline is not reproduced.
+genome_assembly: "ASM2657151v2"
+annotation_version: "GCF_026571515.1-RS_2023_10"
+
+assay_type: ["rnaseq"]
+analysis_mode: "raw_reanalysis"
+platform: "Illumina NovaSeq 6000, Lexogen QuantSeq 3' mRNA-Seq FWD (3' Tag) libraries, 75 bp single-end (76 bp per ENA); 5.1-8.5 M reads per library; 7.9 GB FASTQ reported by ENA. Deposited as library_selection PolyA."
+
+data_availability:
+ raw_data_available: true
+ processed_data_available: false
+ status: "available"
+ access_notes: "Raw single-end FASTQ for all 40 RNA-seq libraries are public in ENA/SRA under PRJNA906528 (first public 2023-07-01). The project also holds 39 paired-end 16S amplicon runs from the same RNA; the sample sheet keeps only library_strategy RNA-Seq. The paper's DEG tables are per sex after RUVs normalization and would not be reproduced here. Sample sheet and FASTQ manifest with ENA MD5s were generated from ENA metadata; sequence data are not committed."
+
+qc_status: "passed_with_warnings"
+analysis_status: "harmonized"
+
+comparisons:
+ - comparison_id: "heatwave_30c_vs_control_20c"
+ tissue: "digestive_gland"
+ life_stage: "adult"
+ stressor_original: "Simulated marine heatwave: 30 C for 30 days, reached by a gradual 2-day increase from 20 C, against controls kept at 20 C for 30 days (Peruzza et al. 2023, section 2.3). BioSample attribute 'temp: 30' vs 'temp: 20'."
+ stressor_standardized: "temperature"
+ exposure_intensity: "30 C constant vs 20 C constant (+10 C)"
+ exposure_duration: "30 d"
+ exposure_timing: "sampled at the end of the 30 d exposure, at temperature; no mortality difference, so no survivor selection"
+ control_condition: "Clams held at 20 C for 30 d (condition 20); 20 clams, 5 from each of 4 tanks"
+ treatment_condition: "Clams held at 30 C for 30 d after a 2-day ramp (condition 30); 20 clams, 5 from each of 4 tanks"
+ phenotype: "thermal_tolerance"
+ phenotype_direction: "not_applicable"
+ phenotype_unit: null
+ resilience_classification: "exposure_only"
+ sample_size: 40
+ biological_replicates: 4
+ results_file: "data/studies/PERUZZA2023_HEATWAVE/PERUZZA2023_HEATWAVE_heatwave_30c_vs_control_20c_dge_standardized.tsv"
+ meta_analysis_primary: true
+
+quality_flags:
+ - raw_data_available
+ - tank_level_replication
+ - single_timepoint
+ - unbalanced_design
+
+limitations: >
+ (1) 3' Tag-Seq libraries (Lexogen QuantSeq FWD, 75 bp single-end), as in
+ TUCCI2025_HEAT_PRIMING. Counts do not scale with transcript length, so the
+ run must set tag_seq = true (fastp poly-X trimming, Salmon
+ --noLengthCorrection, DESeq2 without length offsets); the workflow
+ manifest's deseq2_design.length_model must read "none". Gene-level 3'
+ counts depend on the RefSeq annotation's 3' ends on a contig-level assembly;
+ Salmon mapped 37.5-52.5% of reads (mean 48.9%), as for Tucci (42-49%),
+ consistent with many 3' tags falling beyond annotated transcript ends.
+ (2) Tank is the unit of treatment: 4 tanks per arm, 5 clams sampled from
+ each. Tank membership is not in the deposit or the paper, so the analysis
+ cannot be fitted on tanks. Following the decision for TUCCI2025_HEAT_PRIMING
+ (sr320, 2026-10-12), it is fitted on clams: lfcSE ignores tank-to-tank
+ variation and adjusted p-values are optimistic by an amount these data
+ cannot estimate. Four tanks per arm is better than Tucci's two, but treat
+ significance calls as an upper bound. If tank IDs arrive, refit with
+ --replicate_unit.
+ (3) Sex. The deposited sex is a classifier's prediction from each clam's
+ digestive-gland transcriptome, not an observation, and the arms are
+ unbalanced (20 C: 15 male, 5 female; 30 C: 10 and 10). Sex is fitted as a
+ covariate. The authors report a stronger heatwave response in males and
+ analysed the sexes separately; a pooled ~ sex + condition fit estimates an
+ average heatwave effect and does not test the sex difference.
+ Misclassified sex would leave residual confounding.
+ (4) Exposure only. The heatwave was chosen to be non-lethal and survival
+ did not differ, so no sequenced clam differs in a tolerance outcome. The
+ sublethal phenotypes the paper measured (hepato-somatic index, oocyte size,
+ burying, filtration) are not encoded as the comparison's phenotype. Pooled
+ with Tucci's naive heatwave contrast, this is replicated evidence of a heat
+ response in clams, not of heat tolerance.
+ (5) The two arms differ in temperature at sampling (30 vs 20 C), so the
+ contrast mixes the acute state at 30 C with 30 days of acclimation; Tucci's
+ contrast was sampled after 15 d recovery at a common 25 C. The pool
+ therefore spans different timing, which the meta-analysis heterogeneity
+ will reflect.
+ (6) Single timepoint, single tissue (digestive gland, which includes some
+ gonad, so reproductive genes reflect gonad state as well as the gland).
+ One hatchery stock, shared with Tucci.
+
+provenance:
+ registered_by: "Steven Roberts"
+ date_registered: "2026-10-15"
+ curation_notes: >
+ Claimed with `aree start-study --accession PRJNA906528 --study-id
+ PERUZZA2023_HEATWAVE` (draft PR #64). Sample sheet and FASTQ manifest
+ generated from live ENA metadata with `aree fetch-samplesheet --bioproject
+ PRJNA906528 --study PERUZZA2023_HEATWAVE --condition-attribute temp
+ --attribute sex --library-strategy RNA-Seq`; the provenance records the
+ filter (kept RNA-Seq; 40 RNA-Seq and 39 AMPLICON runs before filtering).
+ ENA returned HTTP 500 on the first attempt and succeeded on retry.
+ LIBRARY-TYPE CHECK: ENA says PolyA; the paper says QuantSeq 3' mRNA-Seq
+ FWD. The reads agree with the paper: in about 74,000 reads of SRR22444642,
+ 11.8% contain a run of 10 A and 0.1% a run of 10 T, against 4.3% and 0.1%
+ for a known QuantSeq library from TUCCI2025_HEAT_PRIMING (SRR29712776). A
+ one-sided poly-A signal is the forward 3' Tag-seq signature.
+ REPLICATION CHECK: 40 distinct BioSamples and 40 distinct sample aliases
+ (CTRL-, HW-), 20 per temperature, matching the paper's 5 clams from
+ each of 4 tanks per arm. Tank membership is not recorded (limitation 2).
+ Distinct names do not prove distinct animals: run
+ scripts/check_replicate_dispersion.py after quantification.
+ MAPPING: tissue 'digestive gland' maps to digestive_gland; adult clams map
+ to adult. The GCF_026571515.1 reference bundle is the one fetched and
+ verified for TUCCI2025_HEAT_PRIMING on 2026-10-12.
+ PUBLICATION: the backlog listed none; found by searching the BioProject
+ title. The open copy used for curation is the University of Padova
+ repository PDF of the published version.
+ REANALYSIS (Pori, 2026-10-16 to 17): all 40 RNA-seq FASTQs (7.9 GB) were
+ downloaded fresh over HTTPS from ENA and accepted only at manifest size
+ and ENA MD5. The first download attempt was ended by an external
+ termination signal at 19:51 on 2026-10-16 (it stopped another session's
+ download at the same moment) after 12 files; the restart kept those 12
+ and re-fetched the rest, all 40 verified at 00:01 on 2026-10-17. The
+ comparison ran natively (-profile local,workstation, 8 GB resource
+ config) with tag_seq = true and covariates = sex, reusing the
+ GCF_026571515.1 Salmon index saved from TUCCI2025_HEAT_PRIMING: 125
+ tasks, 21 m 40 s, no failures. The manifest records tag_seq true, design
+ ~sex + condition, length_model "none: counts without length offsets
+ (tag_seq)", 40 libraries, residual df 37, every reference file matching
+ the bundle provenance, and no warnings. Replicate dispersion QC
+ (scripts/check_replicate_dispersion.py, replicate_dispersion_qc.tsv)
+ passes: median dispersion 0.097 (20 C) and 0.093 (30 C) on about 900
+ genes per group with mean count >= 500, close to Tucci's 0.08-0.12.
+ Harmonized against rphil_gene_id_crosswalk.tsv: all 32,634 records
+ resolve exact; 29,508 carry an orthogroup from the active run. DESeq2
+ calls at padj < 0.05: 2,993 (1,386 up, 1,607 down).
+ source_links:
+ - "https://www.ncbi.nlm.nih.gov/bioproject/PRJNA906528"
+ - "https://www.ebi.ac.uk/ena/browser/view/PRJNA906528"
+ - "https://doi.org/10.1016/j.marpolbul.2023.115192"
+ - "https://www.research.unipd.it/retrieve/feff46d3-23a2-40f5-a95a-82448f895ee8/64-Peruzza%20et%20al.%202023.pdf"
diff --git a/tests/test_peruzza2023_study.py b/tests/test_peruzza2023_study.py
new file mode 100644
index 0000000..562301f
--- /dev/null
+++ b/tests/test_peruzza2023_study.py
@@ -0,0 +1,117 @@
+"""Curation tests for PERUZZA2023_HEATWAVE.
+
+The second real Manila clam study: 30 vs 20 C for 30 days, 20 clams per arm
+from 4 tanks each, 3' Tag-Seq of digestive gland. These tests pin the design
+read from ENA and the decisions that are easy to erode later: the 16S amplicon
+runs that share the BioProject are excluded, the one prespecified comparison
+and its exposure-only classification, the tank caveat, sex as a covariate, and
+that the run took the workflow's 3' Tag-seq path (tag_seq = true).
+"""
+from __future__ import annotations
+
+import csv
+import json
+import re
+from collections import Counter
+
+import pytest
+import yaml
+
+from common import DATA_DIR, REPO_ROOT, STUDIES_DIR
+
+STUDY_ID = "PERUZZA2023_HEATWAVE"
+STUDY_PATH = STUDIES_DIR / f"{STUDY_ID}.yaml"
+STUDY_DIR = DATA_DIR / "studies" / STUDY_ID
+CONFIG_PATH = REPO_ROOT / "config" / f"{STUDY_ID}.config"
+CID = "heatwave_30c_vs_control_20c"
+
+
+@pytest.fixture(scope="module")
+def study():
+ return yaml.safe_load(STUDY_PATH.read_text())
+
+
+@pytest.fixture(scope="module")
+def samplesheet():
+ with open(STUDY_DIR / "samplesheet.tsv", encoding="utf-8") as fh:
+ return list(csv.DictReader(fh, delimiter="\t"))
+
+
+@pytest.fixture(scope="module")
+def ena_provenance():
+ return json.loads((STUDY_DIR / "ena_provenance.json").read_text())
+
+
+@pytest.fixture(scope="module")
+def manifest():
+ return json.loads((STUDY_DIR / f"{STUDY_ID}_{CID}_workflow_manifest.json").read_text())
+
+
+def test_study_validates():
+ from intake.schema_validate import validate_study_file
+
+ result = validate_study_file(STUDY_PATH)
+ assert result.valid, result.errors
+
+
+def test_samplesheet_keeps_only_the_rnaseq_runs(samplesheet, ena_provenance):
+ """The BioProject also holds 39 paired-end 16S amplicon runs from the same RNA."""
+ assert ena_provenance["bioproject"] == "PRJNA906528"
+ assert ena_provenance["library_strategy_filter"] == {
+ "kept": ["RNA-Seq"], "runs_by_strategy_before_filter": {"AMPLICON": 39, "RNA-Seq": 40}}
+ assert len(samplesheet) == ena_provenance["n_runs"] == ena_provenance["n_samples"] == 40
+ assert {r["library_layout"] for r in samplesheet} == {"SINGLE"}
+
+
+def test_twenty_distinct_clams_per_temperature_with_unbalanced_sex(samplesheet):
+ assert Counter(r["condition"] for r in samplesheet) == {"20": 20, "30": 20}
+ assert len({r["sample_accession"] for r in samplesheet}) == 40
+ assert len({r["sample_alias"] for r in samplesheet}) == 40
+ sex = Counter((r["condition"], r["sex"]) for r in samplesheet)
+ assert sex == {("20", "male"): 15, ("20", "female"): 5, ("30", "male"): 10, ("30", "female"): 10}
+
+
+def test_one_primary_comparison_classified_exposure_only(study):
+ """A non-lethal heatwave with no survival difference: exposure, not tolerance."""
+ (comp,) = study["comparisons"]
+ assert comp["comparison_id"] == CID and comp["meta_analysis_primary"] is True
+ assert comp["resilience_classification"] == "exposure_only"
+ assert comp["phenotype"] == "thermal_tolerance"
+ assert comp["tissue"] == "digestive_gland" and comp["stressor_standardized"] == "temperature"
+ assert comp["biological_replicates"] == 4
+
+
+def test_tank_replication_tag_seq_and_status_are_declared(study):
+ assert {"tank_level_replication", "unbalanced_design"} <= set(study["quality_flags"])
+ assert "3' Tag" in study["platform"]
+ assert study["analysis_status"] == "harmonized"
+ assert study["qc_status"] == "passed_with_warnings"
+
+
+def test_config_runs_the_tag_seq_path_with_sex_as_covariate(samplesheet):
+ text = CONFIG_PATH.read_text(encoding="utf-8")
+ assert re.search(r"^\s*tag_seq\s*=\s*true\b", text, re.M)
+ assert re.search(r"^\s*covariates\s*=\s*'sex'", text, re.M)
+ levels = set(re.findall(r"(?:control_level|treatment_level)\s*=\s*'([^']+)'", text))
+ assert levels == {"20", "30"} <= {r["condition"] for r in samplesheet}
+ block = re.search(r"rnaseq \{(.*?)\}", text, re.S).group(1)
+ assert re.search(r"comparison_id\s*=\s*null", block)
+
+
+def test_the_committed_run_is_the_one_registered(study, manifest):
+ """tag_seq, no length offsets, sex fitted, 20 vs 20 clams, reference as fetched."""
+ assert (REPO_ROOT / study["comparisons"][0]["results_file"]).exists()
+ assert manifest["parameters"]["tag_seq"] is True
+ assert manifest["deseq2_design"]["design"] == "~sex + condition"
+ assert manifest["deseq2_design"]["length_model"].startswith("none")
+ assert manifest["deseq2_design"]["n_libraries_or_units"] == 40
+ assert manifest["deseq2_design"]["residual_df"] == 37
+ assert all(f.get("matches_bundle_provenance", True) for f in manifest["reference"]["files"])
+ assert manifest["warnings"] == []
+
+
+def test_replicate_dispersion_qc_passes():
+ with open(STUDY_DIR / "replicate_dispersion_qc.tsv", encoding="utf-8") as fh:
+ rows = list(csv.DictReader(fh, delimiter="\t"))
+ assert {r["condition"] for r in rows} == {"20", "30"}
+ assert all(r["passes"] == "True" for r in rows)
